Detail of EST/Unigene SRR546165.306811
Acc. SRR546165.306811
Internal Acc. G16PS2N02GWVDY_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=6e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Cucumis sativus E-value=7e-09; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Larrea tridentata E-value=7e-09; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Larrea tridentata E-value=7e-09;
Length 90 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence CGTCGAGATCGTTGATGAATAGGGCACACATCTTCCCCTTCTTGATGATATCAGCGGCTT
CACGGTACCTCTGCCTGATCAGCTTCGCTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A