Detail of EST/Unigene SRR546165.307359 |
Acc. | SRR546165.307359 |
Internal Acc. | G16PS2N02FTFDR |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=4e-52; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=7e-52; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=7e-52; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=7e-52; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=9e-52; |
Length | 309 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TCTGGGCTGTGTCTTCCCCGAACTCTTGGCCCGCAATGGGGTCAAGTTCGGTGAGGCCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |