Detail of EST/Unigene SRR546165.307987 |
Acc. | SRR546165.307987 |
Internal Acc. | G16PS2N02HJN5T |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=2e-22; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=1e-20; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-20; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=4e-20; 30S ribosomal protein S14 OS=Caulobacter sp. (strain K31) E-value=4e-16; |
Length | 292 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | AAGAATTTAAAAAAATACCGGCAAAGGAGATGAAATCCTGTTTGGGCGCGGGCGCCATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |