Detail of EST/Unigene SRR546165.311033 |
Acc. | SRR546165.311033 |
Internal Acc. | G16PS2N02GFDIU |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=6e-19; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=8e-19; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=7e-18; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=3e-17; 30S ribosomal protein S14 OS=Protochlamydia amoebophila (strain UWE25) E-value=3e-14; |
Length | 276 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | ATGAGGTCCGTGAGGAGAATCGCTACAAGCTCGCTAAGCTTCCCAGAAACAGCTCCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |