Detail of EST/Unigene SRR546165.311820 |
Acc. | SRR546165.311820 |
Internal Acc. | G16PS2N02JJ3OO |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=3e-21; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=3e-20; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-19; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-19; 30S ribosomal protein S14 OS=Protochlamydia amoebophila (strain UWE25) E-value=5e-15; |
Length | 281 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TCCCAGCCTTCCCGATGAGGTCCGTGAGGAGAATCGCTACAAGCTCGCTAAGCTTCCCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |