Detail of EST/Unigene SRR546165.317119 |
Acc. | SRR546165.317119 |
Internal Acc. | G16PS2N02FLO9A |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=3e-31; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-31; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-30; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-30; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=6e-30; |
Length | 304 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | AATGGCTCTCTCCTCTCCATCTTTTGCAGGCCAAGCTGTGAGGCTTGCTCCTGCACCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |