Detail of EST/Unigene SRR546165.320176
Acc. SRR546165.320176
Internal Acc. G16PS2N02JVGMW
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic OS=Hordeum vulgare E-value=1e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Vigna radiata var. radiata E-value=2e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Spinacia oleracea E-value=4e-09; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=4e-09;
Length 83 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence CCAATCCGGTCATCCCTAGTAGGAGCCCAGTAGAATTTCTCCATACGACCGTCACGAATG
AGAGGTGCATACAAAGTTGAGAA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A