Detail of EST/Unigene SRR546165.322804 |
Acc. | SRR546165.322804 |
Internal Acc. | G16PS2N02IR5C4 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=6e-26; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=9e-26; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=9e-26; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=9e-26; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=9e-26; |
Length | 285 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | CCCAGGTGGAAGCTTTGACCCATTGGGGGCTTGCTGAGGACCCAGAGGCTTTTGCTGAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |