| Detail of EST/Unigene SRR546165.323237 |
| Acc. | SRR546165.323237 |
| Internal Acc. | G16PS2N02F4C0Q |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=8e-16; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=8e-16; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=8e-16; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-15; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-15; |
| Length | 113 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | CAGCTGTGTCCCAACCGTAATCGCCGGGAAACTCTCCGGTGAGGTAGGATGGGGCCTCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |