Detail of EST/Unigene SRR546165.7098 |
Acc. | SRR546165.7098 |
Internal Acc. | G16PS2N02F41EW |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic OS=Glycine max E-value=2e-19; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=3e-18; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=1e-17; Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=5e-10; |
Length | 211 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | GAGCATTGTCTATACTCCTGCTGCAGCTTTAGCCTCAGAATCCGTCTTTCCCTCAGATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |