Detail of EST/Unigene SRR546165.73971 |
Acc. | SRR546165.73971 |
Internal Acc. | G16PS2N02F8DVF_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=8e-24; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=4e-23; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=1e-22; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=6e-22; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=8e-22; |
Length | 149 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TGGCCAGCCGATTTTACGATACGACGATATGTGGGCTGATTGGTGTATCAAGGTTATCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |