| Detail of EST/Unigene SRR546165.78344 |
| Acc. | SRR546165.78344 |
| Internal Acc. | G16PS2N02HSWKD_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=7e-25; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=1e-23; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=7e-23; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-22; Cysteine synthase OS=Citrullus lanatus E-value=5e-21; |
| Length | 270 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | CCAACCTTGATTGCAGCAGCTGCTGCTGCTCCAGAAGAAATTCCAACCAACAAGCCCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |