Detail of EST/Unigene SRR546165.7907 |
Acc. | SRR546165.7907 |
Internal Acc. | G16PS2N02GRQ6Y |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=2e-31; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=2e-27; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=2e-26; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=3e-20; |
Length | 393 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TTAAGTGGTCGACAACCTCGTTGGAACTACTAAGATGTTGCAAATCAGATCGGTGAAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |