| Detail of EST/Unigene SRR546165.85275 |
| Acc. | SRR546165.85275 |
| Internal Acc. | G16PS2N02IA2E3 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=2e-28; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=1e-17; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=2e-12; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-11; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Spinacia oleracea E-value=5e-07; |
| Length | 402 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | CCTCACTCTAAGGCCTAAACCGGTTGTTGCTGAGACTCCAAGGGAATTCCAAGCTCTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |