Detail of EST/Unigene SRR546165.92085 |
Acc. | SRR546165.92085 |
Internal Acc. | G16PS2N02ICEV0_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=8e-21; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-20; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-19; |
Length | 341 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | GATCCCAAGGAGAACAAAGCTTGAAACTTCTCTTCTCTTTCATTGCTTGTAAATCATAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |