Detail of EST/Unigene SRR546165.92363 |
Acc. | SRR546165.92363 |
Internal Acc. | G16PS2N02G18RF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=7e-44; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=3e-43; Bifunctional L-3-cyanoalanine synthase/cysteine synthase, mitochondrial OS=Spinacia oleracea E-value=2e-33; L-3-cyanoalanine synthase 1, mitochondrial OS=Malus domestica E-value=3e-33; L-3-cyanoalanine synthase 2, mitochondrial OS=Malus domestica E-value=4e-33; |
Length | 352 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | CCACAAGTGGAAACACTGGTATCGGTCTTGCATTTATTGCTGCCTCGAAAGGATATAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |