Detail of EST/Unigene SRR546165.97983 |
Acc. | SRR546165.97983 |
Internal Acc. | G16PS2N02JGY5Z |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=4e-34; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=5e-34; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=9e-34; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-34; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-34; |
Length | 377 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TACAACATCTGTATGAGTTACAAACAAAGGAATGTATGGAAAGAGCAAGGCTCTCACTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |