| Detail of EST/Unigene SRR546168.100335 |
| Acc. | SRR546168.100335 |
| Internal Acc. | G2HQ8GE01EP60N_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=3e-50; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-50; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-50; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=5e-50; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=7e-50; |
| Length | 288 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | CTAAAATGCTCTGAGCATGGACCAAGTTTGGGTTTCCCAAGTAGTCAAGTCCACCGTCGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |