Detail of EST/Unigene SRR546168.11475
Acc. SRR546168.11475
Internal Acc. G2HQ8GE01EZZ5I
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-06; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-06; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=2e-06; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-06; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-06;
Length 77 nt
Species Humulus lupulus
Belonged EST Libraries SRR546168;
Sequence TGGGAGTTTTGACCCATTGGGGCTTGCTGAGGACCCAGAGGCTTTTTCTGAGCTGAAGGT
GAAGGAACTCAAGAATG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A