| Detail of EST/Unigene SRR546168.128656 |
| Acc. | SRR546168.128656 |
| Internal Acc. | G2HQ8GE01A4D93 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=1e-29; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=1e-29; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=7e-28; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=9e-20; Pyruvate carboxylase subunit A OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=4e-13; |
| Length | 182 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | AAGAAATTGTGCTCAGAGGACATTCAATTGAGTGCCGTATCAATGCTGAAGATGCTTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |