Detail of EST/Unigene SRR546168.132752 |
Acc. | SRR546168.132752 |
Internal Acc. | G2HQ8GE01CKMJA_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha,alpha-trehalose-phosphate synthase [UDP-forming] 6 OS=Arabidopsis thaliana E-value=9e-10; Alpha,alpha-trehalose-phosphate synthase [UDP-forming] 5 OS=Arabidopsis thaliana E-value=7e-07; Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 9 OS=Arabidopsis thaliana E-value=3e-06; |
Length | 101 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | CAGAATGGGAAACATGTCTACCAGTTGCTGATTGTAGTTGGAAGCAGATTGCTGAGCCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |