| Detail of EST/Unigene SRR546168.25417 |
| Acc. | SRR546168.25417 |
| Internal Acc. | G2HQ8GE01AVQM4 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Phaseolus vulgaris E-value=4e-07; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=7e-07; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Vigna radiata var. radiata E-value=3e-06; |
| Length | 88 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | TCTTCCCAATGCTGTCCACTCCCACTCCTGATATCCACTTCCTCACTTCGTCGTCGTAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |