Detail of EST/Unigene SRR546168.28635 |
Acc. | SRR546168.28635 |
Internal Acc. | G2HQ8GE01D80CJ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-11; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-11; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=8e-11; |
Length | 319 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | ACCCTGCAGTTGTTAATCTGAAAGCGAAAACTCATGAAAAGGTTGACAGCCTCGGCGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |