Detail of EST/Unigene SRR546168.32855 |
Acc. | SRR546168.32855 |
Internal Acc. | G2HQ8GE01CGAKJ_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calmodulin-related protein OS=Petunia hybrida E-value=3e-13; Calmodulin OS=Medicago sativa E-value=3e-13; Calmodulin OS=Malus domestica E-value=3e-13; Calmodulin OS=Lilium longiflorum E-value=3e-13; Calmodulin OS=Helianthus annuus E-value=3e-13; |
Length | 133 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | CAGATCTCCGAGTTCAAGGAGGCTTTCAGCCTATTCGACAAGGACGCGATGGCTGCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |