Detail of EST/Unigene SRR546168.34459 |
Acc. | SRR546168.34459 |
Internal Acc. | G2HQ8GE01AOJ0T |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=2e-43; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-43; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-42; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-42; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=4e-42; |
Length | 323 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | ACACAGCCCAGAGCGCCGAGCATGGCCCATCGCGAGTGGATGACCTCCAGCTCTCGGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |