| Detail of EST/Unigene SRR546168.41168 |
| Acc. | SRR546168.41168 |
| Internal Acc. | G2HQ8GE01C4AH5 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=3e-38; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=3e-37; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=5e-37; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=4e-36; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=7e-36; |
| Length | 372 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | AAGCCAGCTCCATCAACGAGTCACTGTATTTCTCCGTCGCAGCAATCCACCCCTCAGGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |