| Detail of EST/Unigene SRR546168.45102 |
| Acc. | SRR546168.45102 |
| Internal Acc. | G2HQ8GE01B70KB_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=2e-11; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-11; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=3e-11; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=6e-11; Cysteine synthase OS=Spinacia oleracea E-value=2e-10; |
| Length | 124 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | ATGCGTTGGGTGTGCTATTCACTATTTCTTCAGCTTTCTGAACTGCCCCTTTCATGCCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |