| Detail of EST/Unigene SRR546168.49121 |
| Acc. | SRR546168.49121 |
| Internal Acc. | G2HQ8GE01COC9G |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=1e-16; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=2e-16; UDP-arabinopyranose mutase 1 OS=Arabidopsis thaliana E-value=2e-16; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=1e-15; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=2e-15; |
| Length | 163 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | CTGTCTTCACCTCCCCACTCCCAAGTGATCACAGATAACCTTGATACACCAACCAGCCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |