Detail of EST/Unigene SRR546168.55401 |
Acc. | SRR546168.55401 |
Internal Acc. | G2HQ8GE01CVEGL_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 59 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | CTTCAGATTTGAGCTAATCTTCTTTAAGTGTTATCTGTATTGGGCTTTCTATCTTGGAA
|
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |