| Detail of EST/Unigene SRR546168.69096 |
| Acc. | SRR546168.69096 |
| Internal Acc. | G2HQ8GE01BSF12 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=7e-63; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=9e-63; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-62; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-62; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-62; |
| Length | 386 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | TACTAGGGTCCTCAGCAAGCCCCAATGGGTCAAAGCTTCCACCTGGGTACAATGGATCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |