| Detail of EST/Unigene SRR546168.80026 |
| Acc. | SRR546168.80026 |
| Internal Acc. | G2HQ8GE01A944K |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=9e-41; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=9e-40; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=9e-40; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=2e-39; Flavonoid 3',5'-hydroxylase OS=Gentiana triflora E-value=8e-39; |
| Length | 400 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | GGCCGGGGGGGGGTTCTTCAACGTCGGCGACTTCATTCCGTCGATTGCTTGGATGGATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |