Detail of EST/Unigene SRR546168.88322 |
Acc. | SRR546168.88322 |
Internal Acc. | G2HQ8GE01CXMCD |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-09; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-08; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-08; |
Length | 293 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | TGTTTCGGAATGGCTGCTCTAATATCAGCTAACTTAAATGGAGGAGGCGCACCAGGGTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |