Detail of EST/Unigene SRR546168.89047 |
Acc. | SRR546168.89047 |
Internal Acc. | G2HQ8GE01A1YS4 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-41; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Arabidopsis thaliana E-value=9e-39; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Pongo pygmaeus E-value=9e-28; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Pan troglodytes E-value=1e-27; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Pan paniscus E-value=1e-27; |
Length | 358 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | TTCAAAACTGAGGAGGAGGCTATCCGTGTTGCTAATGACACCAACTCAGGGTTAGCCGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |