Detail of EST/Unigene SRR546168.98604 |
Acc. | SRR546168.98604 |
Internal Acc. | G2HQ8GE01BG8L6_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=3e-36; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=1e-35; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=1e-35; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-35; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=2e-35; |
Length | 211 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168; |
Sequence | CCATACGGCCTCACCGAACTTGACCCCATTGCGGGCCAAGAGTTCGGGGAAGACACAGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |