| Detail of EST/Unigene SRR546168.99043 |
| Acc. | SRR546168.99043 |
| Internal Acc. | G2HQ8GE01BDX5G |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=4e-49; Glutathione reductase, chloroplastic OS=Glycine max E-value=4e-47; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=8e-45; Glutathione reductase, cytosolic OS=Oryza sativa subsp. japonica E-value=5e-28; |
| Length | 346 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168; |
| Sequence | CTGTTCTTCAGTAAGACCAACTTGTCCAATCGGTGGTTGCGAAAACACAGCAGAAGGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |