| Detail of EST/Unigene SRR546170.111641 |
| Acc. | SRR546170.111641 |
| Internal Acc. | G2HQ8GE01AU9KK_2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=2e-21; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=8e-21; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-20; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=2e-20; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=3e-19; |
| Length | 181 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170; |
| Sequence | GTCTCGACGGAGGCATGCCAAGTGGACGGCTACTACATCCCGAAGAACACGCGGCTGAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |