Detail of EST/Unigene SRR546170.111641 |
Acc. | SRR546170.111641 |
Internal Acc. | G2HQ8GE01AU9KK_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=2e-21; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=8e-21; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-20; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=2e-20; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=3e-19; |
Length | 181 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | GTCTCGACGGAGGCATGCCAAGTGGACGGCTACTACATCCCGAAGAACACGCGGCTGAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |