Detail of EST/Unigene SRR546170.113183 |
Acc. | SRR546170.113183 |
Internal Acc. | G2HQ8GE01BZUV6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=1e-28; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=9e-23; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=3e-22; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=4e-16; |
Length | 374 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | AAGGACTGTGCATGTTTTGTAGGTTGCCAACCATGTCTTTTAAGTGGTCGACAACCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |