Detail of EST/Unigene SRR546170.117201 |
Acc. | SRR546170.117201 |
Internal Acc. | G2HQ8GE01DIWNT_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-28; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=3e-28; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=3e-28; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=2e-27; Cysteine synthase OS=Spinacia oleracea E-value=2e-27; |
Length | 240 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | ACTGTTAGGTGTGTTCTTTAGCAGCTCTAAAGCCTTATCTAGACCCCCTTTAAGGGCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |