| Detail of EST/Unigene SRR546170.119431 |
| Acc. | SRR546170.119431 |
| Internal Acc. | G2HQ8GE01BY80C_2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=4e-10; Hydroxymethylglutaryl-CoA synthase 2 OS=Blattella germanica E-value=1e-06; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=2e-06; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=2e-06; |
| Length | 100 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170; |
| Sequence | CTGATCTTGCGAGTGAATATCCGGTTGTTGATGGAAAGCTTTCACAAACATGTTATCTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |