Detail of EST/Unigene SRR546170.143156
Acc. SRR546170.143156
Internal Acc. G2HQ8GE01ANY1B_1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain 1A, chloroplastic OS=Arabidopsis thaliana E-value=3e-11; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Fagus crenata E-value=5e-11; Ribulose bisphosphate carboxylase small chain 2B, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Ribulose bisphosphate carboxylase small chain 1B, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Gossypium hirsutum E-value=8e-11;
Length 116 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence CTTCACGTTCCTTGGTGGCCACACCTTCATGCACTGAACTCTTCCACCGTTGCTGGTGAT
GGAGGTAATGTCGTTGTTGGCCTTCTTGGTGCTGGGGAAAGCAGCAGCGGACTTGA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A