Detail of EST/Unigene SRR546170.153547 |
Acc. | SRR546170.153547 |
Internal Acc. | G2HQ8GE01AP9UZ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-26; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-26; |
Length | 235 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | TCACCTTCACCAAGTGGCCCACCTCCTAATTTCTGTACCCCTCTACAGCTCCCATTAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |