| Detail of EST/Unigene SRR546170.15895 |
| Acc. | SRR546170.15895 |
| Internal Acc. | G2HQ8GE01AML0I |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=5e-11; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-10; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-10; |
| Length | 340 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170; |
| Sequence | GTCGTCGTCGTTTTTGGTTTGGCGGCTGTGGCGGCTTATTTTAACAATTGGGCCGTTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |