| Detail of EST/Unigene SRR546170.162598 |
| Acc. | SRR546170.162598 |
| Internal Acc. | G2HQ8GE01AGXDJ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=5e-24; Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=6e-24; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=1e-23; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-16; |
| Length | 280 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170; |
| Sequence | CTGTTCCTTGGAGTTTCCTGGATTCGAGCTCGTGTTCATTTGGATTCTTTCGTGATGATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |