| Detail of EST/Unigene SRR546170.35270 |
| Acc. | SRR546170.35270 |
| Internal Acc. | G2HQ8GE01ELDHX_2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 84 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170; |
| Sequence | GAGGCTTTAGAGCATTTAGGGGCTGATTCTTACCTGGTTAGCTCCGACTCGGCCGAGATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |