Detail of EST/Unigene SRR546170.3798 |
Acc. | SRR546170.3798 |
Internal Acc. | G2HQ8GE01DD5H9 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=5e-11; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-10; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-10; |
Length | 332 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | GTCGTCGTCGTTTTTGGTTTGGCGGCTGTGGCGGCTTATTTTAACAATTGGGCCGTTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |