Detail of EST/Unigene SRR546170.86536 |
Acc. | SRR546170.86536 |
Internal Acc. | G2HQ8GE01APBLK |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=3e-37; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=5e-36; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-35; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=1e-22; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=1e-22; |
Length | 297 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | AAAATGAATCTAACCACCAAGAGATGATCGATAACCTTGAACTGCTCTAGCGTTGCATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |