Detail of EST/Unigene SRR546170.89340
Acc. SRR546170.89340
Internal Acc. G2HQ8GE01BSEUV_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 3 [UDP-forming] OS=Arabidopsis thaliana E-value=1e-10; Probable cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=1e-09; Probable cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Oryza sativa subsp. indica E-value=1e-09; Probable cellulose synthase A catalytic subunit 8 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=1e-09; Cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Arabidopsis thaliana E-value=4e-07;
Length 100 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence GATGACGAGAAGTCGTTGCTTATGTCACAAATGAGTCTCGAGAAAAGATTTGGTCAGTCC
GCTGTCTTTGTTGCCTCGACGCTCATGGAGAATGGCGGTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A