Detail of EST/Unigene SRR546170.93323 |
Acc. | SRR546170.93323 |
Internal Acc. | G2HQ8GE01DP8B3 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-53; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-52; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-51; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-51; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-51; |
Length | 336 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170; |
Sequence | CCATATTTGGACAGATACTGATAATAATCGAGCTGGCATGCTTCCCTTTGTTTTTGATGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |