| Detail of EST/Unigene SRR546172.118531 |
| Acc. | SRR546172.118531 |
| Internal Acc. | G2HQ8GE01EDZLJ_2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L3 OS=Oryza sativa subsp. japonica E-value=9e-15; 60S ribosomal protein L3-2 OS=Arabidopsis thaliana E-value=2e-14; 60S ribosomal protein L3-1 OS=Arabidopsis thaliana E-value=6e-14; 60S ribosomal protein L3 OS=Rattus norvegicus E-value=5e-13; 60S ribosomal protein L3 OS=Mus musculus E-value=5e-13; |
| Length | 108 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | TAGCATGTATTGGTGCATGGCATCCTGCTAGAGTTTCATTTACAGTTGCTCGAGCCGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |