| Detail of EST/Unigene SRR546172.131758 |
| Acc. | SRR546172.131758 |
| Internal Acc. | G2HQ8GE01E38SK |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=2e-21; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=7e-20; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-19; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=7e-17; 30S ribosomal protein S14 OS=Phenylobacterium zucineum (strain HLK1) E-value=1e-10; |
| Length | 285 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | AGATTGGAAAGGAGTAGCGAAAACTGAAAGCAATGTCGGATTCTCGTGAAGTGGGGAAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |